circad | circRNAs associated with diseases

hsa_circ_0000064
Gene	B4GALT2	Organism	Human
Genome Locus	chr1:44446997-44447136:-	Build	hg19
Disease	Lung Cancer	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink	Link to database	PMID	29223555
Experimental Method
Sample Type	Tissues and A549,H1299 Cell lines	Comparison	Tissue samples of lung cancer and paired normal tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AGCAGGCTGACAGTGGAGTT Reverse CAGCACATGCAGGAACAAAA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Luo, YH, Zhu, XZ, Huang, KW, Zhang, Q, Fan, YX, Yan, PW, Wen, J (2017). Emerging roles of circular RNA hsa_circ_0000064 in the proliferation and metastasis of lung cancer. Biomed. Pharmacother., 96:892-898.